Metadata

Whitelist

The whitelist is a set of cell barcodes you expect your reads to come from. This is usually specified by the technology and can be found online.

Here you can find the 10Xv3 cell barcodes in my github mirror. But you can also find them in your installation of CellRanger or kallisto.

Note:

You will use the same whitelist for both the 10X sequences and the PCR sequences as they come from the same set of cells. This step is not required if you are aligning with kallisto because it can provide you with the same whitelist. But it will save space to just provide this file as otherwise it will write to disk the same whitelist for each sample you process

# Download the 10X v3 Whitelist from my github mirror
wget \
  https://github.com/noamteyssier/10x_whitelist_mirror/raw/main/3M-february-2018.txt.gz \
  project_name/meta/whitelist/3M-february-2018.txt.gz

Kallisto Index

The index is a kmer de-bruijn graph representation of the transcriptomic sequences you will be aligning your 10X sequences to.

Note:

If you are interested in learning more about the kallisto index I highly recommend reading the kallisto paper which describes the pseudo-alignment algorithm and the index. {{#cite bray_near-optimal_2016}}

If you are interested in building your own reference index please check out the kb tutorial

For the purposes of this tutorial we will be using a prebuilt index generated for RNA velocity analyses.

We will also be building our own index in an upcoming section so you can look at how to do that there as well.

RNA Velocity Transcriptome

Even if you are not interested in doing an RNA velocity analysis - it doesn't hurt you to align to a spliced/unspliced reference.

The counts are aggregated between the spliced/unspliced records in the downstream data, but you have an added option of observing the splice/unsplice ratio

# moving to the planned directory
cd project_name/meta/index/

# Downloading the Reference Index
kb ref \
  -d linnarsson \
  -i index.idx \
  -g t2g.txt \
  -c1 spliced_t2c.txt \
  -c2 unspliced_t2c.txt

The above command will download the reference index and create the following files:

  1. project_name/meta/10X_index/index.idx
  2. project_name/meta/10X_index/t2g.txt
  3. project_name/meta/10X_index/spliced_t2c.txt
  4. project_name/meta/10X_index/unspliced_t2c.txt

These will be used in the next section when we run our 10X alignment.

Target Sequences

The cropseq.fa file here is a stand-in for the fasta formatted sequences of your expected guide sequences.

You will want to place this under project_name/meta/pcr_index/

Filename: cropseq.fa

>rs17057051_i1
TTGTCCAGCATTCTGCTTCAATGGTTTAAGAGC
>rs17057051_i2
TTGGTCTCCATTGAAGATGTGTTGTTTAAGAGC
              ...
>rs1532277_i1
TTGCAGAACTCTAGCAAGACGTGGTTTAAGAGC
>rs1532277_i2
TTGGAATCTGGGCATTAGGCCCTGTTTAAGAGC

Final Directory Structure

I highly recommend you have a directory structure like the following for your project.

Downstream code will be expecting this directory structure but if you feel strongly about your own structure then it can be easily modified for your own interests.

project_name/
└── meta/
    └── whitelist/
        └── 3M-february-2018.txt.gz
    └── 10X_index/
        ├── index.idx 
        ├── t2g.txt
        ├── spliced_t2c.txt
        └── unspliced_t2c.txt
    └── pcr_index/
        └── cropseq.fa
└── sequence/
    └── 10X/
        ├── sampleX_R1.fastq.gz
        ├── sampleX_R2.fastq.gz
        :        ...
        ├── sampleY_R1.fastq.gz
        └── sampleY_R2.fastq.gz
    └── pcr/
        ├── sampleX_R1.fastq.gz
        ├── sampleX_R2.fastq.gz
        :        ...
        ├── sampleY_R1.fastq.gz
        └── sampleY_R2.fastq.gz